Transforming Growth Factor-β1 Increases Sclerostin In Fibroblasts Of The Periodontal Ligament And The Gingiva

Abstract

Sclerostin (SOST) is a key regulator of bone formation and is expressed in bone, but also in the periodontium. A novel strategy for periodontal regeneration targets sclerostin via the application of antibodies. However, the role of SOST in physiology, pathology, and regeneration in the periodontium is not fully understood. Here we assessed the impact of transforming growth factor-beta1 (TGF-β1) on the expression of SOST in fibroblasts of the gingiva and the periodontal ligament.

Human fibroblasts isolated from the gingiva and the periodontal ligament were stimulated with recombinant human TGF-β1. SOST expression was detected at mRNA levels using quantitative PCR. SOST production at protein levels was assessed via western blot and ELISA. Our data show that fibroblasts treated with TGF-β1 enhanced expression of SOST compared to the untreated control. This increase was paralleled by an increased SOST production at the protein levels. This increase was time dependent. These findings show that in periodontal cells TGF-β1 increases the production of SOST in vitro. Preclinical studies will reveal if this mechanism is involved in physiology, pathology, and regeneration of the periodontium.

Human fibroblasts of the gingiva (GF) and the periodontal ligament (PDLF) were treated with transforming growth factor-beta1 (TGF-β1) for 24 h. Sclerostin (SOST) was assessed at the mRNA level with quantitative PCR (A, B). The bars represent mean + standard deviation relative to the untreated control from 3 donors of GF and 3 donors of PDLF. The protein release of SOST was measured by western blotting in lysates (C, D) and by ELISA in supernatants (E, F) of GF and PDLF. The bars represent mean + standard deviation relative to the untreated control of 2 independent experiments with cells from 3 donors. *p<0.05.

Introduction

Sclerostin (SOST) is a negative regulator of bone formation, acting as inhibitor of Wnt/β-catenin signaling[1][2]. It is expressed in bone but also in the periodontium[3]. SOST is produced during tooth development and has been proposed to be involved in dentin formation[4]. SOST knock out mice show high bone mass and changes in the periodontium[5][5][6][7]. These changes of the periodontium include increased width of cementum and decreased periodontal space width[7]. Furthermore, SOST knock out mice showed enhanced bone healing.

Although these observations underline the importance of SOST in the periodontium, the exact role of SOST in its physiology, pathology, and regeneration is not fully understood. Transforming growth factor-beta1 (TGF-β1) is one of the three known subtypes of human TGF-β that belong to the TGF super family and play crucial roles in periodontal regeneration, cell differentiation, and activity of bone forming osteoblasts and bone resorbing osteoclasts[9]. TGF-β1 can upregulate expression of SOST in human osteoblasts[10]. Furthermore, mechanical forces induce TGF-β1 production in periodontal ligament cells leading to increased expression of SOST[11]. Thus, there are links between TGF-β1 and SOST in the periodontium.

Objective

Our objective was to confirm that TGF-β1 increases the production of SOST in human fibroblasts of the gingiva and the periodontal ligament in vitro.

Results & Discussion

Results: Our data shows that TGF-β1 treatment of fibroblasts of the gingiva and the periodontal ligament with TGF-β1 increased the production of SOST. We found an 7-fold (p<0.05) and 5-fold (p<0.05) increase of SOST production at the mRNA level in gingiva and the periodontal ligament compared to the untreated cells, respectively (Figure A, B). The intracellular SOST protein levels were increased in response to TGF-β1 (Figure C, D). Total SOST protein levels in the conditioned medium of fibroblasts of the gingiva were 4-fold compared to the control but did not reach the level of significance (p>0.05) (Figure E). In fibroblasts of the periodontal ligament SOST levels were 2-fold increased (p<0.05) (Figure F).

Discussion: SOST is a negative regulator of Wnt signaling and thus bone formation. TGF-β1 has been proposed to facilitate the increased SOST production of cells of the periodontal ligament in response to mechanical loading[11]. Our results show that human fibroblasts of the gingiva and the periodontal ligament, treated with TGF-β1, enhanced mRNA levels of SOST compared to the untreated fibroblasts. In line with this observation enhanced SOST levels were found at the protein level in the supernatant and cell lysates of fibroblasts of the gingiva and the periodontal ligament.

These results support the findings on the involvement of TGF-β1 on SOST production, induced by mechanical loading and findings on the effect of TGF-β1 on SOST production in osteoblasts[11][10]. Together, these results highlight the role of TGF-β1 in the regulation of SOST in the periodontium. TGF-β1 can modulate Wnt signaling and increases proliferation of mesenchymal stem cells involving Smad3 and β-catenin[12][13]. The observed increase of SOST by TGF-β1 might be involved in the inhibitory effect of TGF-β1 on differentiation and activity of late osteoblasts [14][15][10] SOST has been advocated as novel target to support periodontal regeneration utilizing antibodies which neutralize SOST[16][17]. In addition, neutralizing SOST supports bone repair in preclinical models and implant osseointegration[18][18].

Conclusions

Our findings show that TGF-β1 can increase SOST in fibroblasts of the gingiva and the periodontal ligament. This is in line with priviouse studies on periodontal liagament cells and osteoblasts[10][9]. Preclinical studies will reveal if this mechanism in involved physiology, pathology, and regeneration in the periodontium.

Limitations

In the present study, we used fibroblasts isolated from the periodontal ligament and the gingiva. Although this population is heterogenic, the periodontium is a highly complex tissue. A clear limitation is of this study is that it is an in vitro study. An analyze SOST mRNA and protein levels in the periodontium in vivo can provide further knowledge on the regulation of SOST in the periodontium[3]. Thus, preclinical studies are required to reveal the response of the periodontium and the role of SOST in vivo. Results from SOST knock out mice underline the relevance of research in this direction[7].

Methods

Cell culture:

Fibroblasts were isolated from the gingiva and from the periodontal ligament from extracted third molars when informed consent was given. This protocol was approved by the Ethics Committee of the Medical University of Vienna, Vienna, Austria (631/2007). Cells were expanded in α minimal essential medium (αMEM) supplemented with 10% fetal calf serum (FCS) and antibiotics.

Fibroblasts of the gingiva and the periodontal ligament were seeded at 50,000 cells per cm². After 24 hours the cells were treated with recombinant human TGF-β1 at 10 ng/ml for 24 hours. Total RNA was isolated for quantitative PCR and cell lysates and conditioned medium was harvested for western blotting and enzyme linked immunosorbent assay (ELISA), respectively.

Reverse transcription quantitative PCR:

Total cellular RNA was isolated from fibroblasts of the gingiva and the periodontal ligament using RNeasy mini kit (Qiagen, Hilden Germany) and DNAse I treatment was performed following the manufacturer’s instructions (Invitrogen Corporation, Carlsbad, CA). Reverse transcription and quantitative PCR were performed with the Super-ScriptTM III Platinum1 SYBR1 Green One-Step qRT-PCR Kit (Invitrogen Corporation) according to the instructions of the manufacturer on a 7000 Real-Time PCR System (Applied Biosystems, Foster City, CA).

The following primers were used to assess Sost mRNA levels: hSost forward CCACCCCTTTGAGACCAAAGACGT, hSost reverse GGCCCATCGGTCACGTAGCG. Human β-actin served as house keeping gene[19] hβ-actin forward GCATCCCCCAAAGTTCACAA, hβ-actin reverse AGGACTGGGCCATTCTCCTT. Amplification was performed at one cycle of 50°C for 3 min followed by one cycle of 95°C for 5 min; 40 cycles of 95°C for 15 s, and 60°C for 30 s, followed by a final cycle of 40°C for 1 min. The ddCt method was used to calculate the relative levels of transcripts.

ELISA:

Conditioned medium from Fibroblasts of the gingiva and the periodontal ligament were subjected to ELISA. SOST levels were measured with the appropriate SOST ELISA kit (Biomedica, Vienna, Austria) according to the protocol of the manufacturer. The optical density obtained from the samples was measured at 450 nm in a spectrometer. The concentration of total SOST was calculated with the standard curve method.

Western blotting:

Fibroblasts of the gingiva and the periodontal ligament were lysed in SDS-buffer [62.5 mM Tris-HCl (pH 6.8), 2% (wt/vol) SDS, 10% (vol/vol) glycerol, 50 mM DTT, 0.01% (wt/vol) bromophenol blue] supplemented with protease inhibitors. Lysates were incubated at 95°C and cell debris was removed by centrifugation at 10,000 g for 10 min at 4°C. About 30 µg total proteins of cell lysates were separated by SDS-PAGE and transferred onto nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ).

Blocking of the membranes was performed with Tris-buffered saline (TBS) containing 0.1% (vol/vol) Tween-20 with 5% wt/vol nonfat dry milk. Antibodies against SOST (R&D Systems, MN, USA) and actin (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:1000 in TBS, 0.1% (vol/vol) Tween-20 with 5% (wt/vol) BSA were applied over night at 4°C. Detection of the first antibody was performed with the appropriate secondary antibody (Dako, Glostrup, Denmark) using the ECL method (Amersham Biosciences).

Statistical analysis:

An analysis of variance (ANOVA) was performed using IBM SPSS Statistics Version 21 (IBM Corporation, Armonk, NY, USA). Significance was assigned p<0.05.

Acknowledgements

The authors thanks Manuela Pensch (Department of Oral Surgery, School of Dentistry, Medical University of Vienna, Austria) for skillful technical assistance and Anna Müller (Department of Conservative Dentistry and Periodontology, School of Dentistry, Medical University of Vienna) and Klara Janjić (Department of Conservative Dentistry and Periodontology, School of Dentistry, Medical University of Vienna) for proofreading.

Ethics Statement

In the present study, we used extracted third molars without signs of inflammation to isolate human fibroblasts after informed consent was obtained. This protocol was approved by the Ethics Committee of the Medical University of Vienna, Vienna, Austria (631/2007).

No fraudulence is committed in performing these experiments or during processing of the data. We understand that in the case of fraudulence, the study can be retracted by ScienceMatters.